View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5823_low_5 (Length: 345)

Name: NF5823_low_5
Description: NF5823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5823_low_5
NF5823_low_5
[»] chr4 (1 HSPs)
chr4 (7-50)||(47304318-47304361)
[»] chr3 (1 HSPs)
chr3 (77-120)||(30354541-30354584)


Alignment Details
Target: chr4 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 7 - 50
Target Start/End: Complemental strand, 47304361 - 47304318
Alignment:
7 gaagaatataatattttctccatttcaaaacgaatgttgcttta 50  Q
    |||||| |||||||||||||||||||||||||||| | ||||||    
47304361 gaagaaaataatattttctccatttcaaaacgaatatcgcttta 47304318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 77 - 120
Target Start/End: Complemental strand, 30354584 - 30354541
Alignment:
77 tttctccaaaattttgtttgtttgttttaaaaggtataatggcg 120  Q
    ||||||||||||| |||||||||||| ||||| |||||||||||    
30354584 tttctccaaaattgtgtttgtttgttctaaaaagtataatggcg 30354541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University