View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5823_low_8 (Length: 259)
Name: NF5823_low_8
Description: NF5823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5823_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 30391026 - 30391281
Alignment:
| Q |
1 |
tcacattgtacccaaatattattcatatgcatttcaagagccttctcaatcgcaatcatgaaagcactgaactctgcttccaaagggcatggaataacca |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| ||||||| |
|
|
| T |
30391026 |
tcacattctacccaaatattattcatatgcatttcaagagccttctcaatcgcaatcatgaaagcattgaactctgcttccaa-gggcatggcataacca |
30391124 |
T |
 |
| Q |
101 |
atattctgcacaagagctcctccaaaaacagcaaggtgagatcgaaacacaatcccaatgacaccatgagaaggatgatccaaagcagagccatcaatgt |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30391125 |
atattctgcacaagagctcctctaaaaacagcaaggtgagatcgaaacacaatcccaatgacaccatgagaaggatgatccaaagcagagccatcaatgt |
30391224 |
T |
 |
| Q |
201 |
cacttagcatgcaccaaaatcaatgtcacttagcaatatccctaccaactgagctaa |
257 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
30391225 |
cacttagcatgcaccaaaatcaatgtcgcttagcaatatccctaacaactgagctaa |
30391281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University