View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5824-Insertion-21 (Length: 237)
Name: NF5824-Insertion-21
Description: NF5824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5824-Insertion-21 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 8 - 237
Target Start/End: Original strand, 26233912 - 26234156
Alignment:
| Q |
8 |
agatcaagcaagaatcagaaaaaatatttgattggtcacctggtaagcctgagataagacctgttctaagggagatttcacgacgaatttcgcggtcacc |
107 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26233912 |
agatcaagcaagaatcagagaaaatatttgattggtcacctggtaagcctgagataagacctgttctaagggagatttcgcgacgaatttcgcggtcacc |
26234011 |
T |
 |
| Q |
108 |
gttgggaatttcaggccaagctatttcagttggtgattcatagagtttataaggttttggattagtcttat---------------gtgatgatgatgat |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26234012 |
gttgggaatttcaggccaagctatttcagttggtgattcatagagtttataaggttttggattagtcttatatgatgatgatgatgatgatgatgatgat |
26234111 |
T |
 |
| Q |
193 |
gtatggagattgtagagggaggttttgtatgcttcccctgtttct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26234112 |
gtatggagattgtagagggaggttttgtatgcttcccctgtttct |
26234156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University