View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5824-Insertion-22 (Length: 204)
Name: NF5824-Insertion-22
Description: NF5824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5824-Insertion-22 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 12 - 204
Target Start/End: Complemental strand, 8375458 - 8375266
Alignment:
| Q |
12 |
aacaacacaacaatccaataattcaacaagacatggacctatggcaatgaatcaaagagtatgataagaaattagtttaagctcctttcacacccgtctt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
8375458 |
aacaacacaacaatccaataattcaacaagacatggacctatggcaatgaatcaaagagtatgataagaaattagctgaagctcctttcacacccgtctt |
8375359 |
T |
|
| Q |
112 |
atccaagaagaagaaacagaaattaaagttgcaacagattcttgggaagccaccgcatagaacccattccaagggcatgacctcaccatctgc |
204 |
Q |
| |
|
|| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
8375358 |
attcaagaagaagaaacagaaattaaaactgcaacagattcttgggaagccaccgcatagaacccattccaagggcgtgagctcaccatctgc |
8375266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University