View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5824_high_24 (Length: 376)
Name: NF5824_high_24
Description: NF5824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5824_high_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 4e-69; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 9 - 200
Target Start/End: Original strand, 29170188 - 29170380
Alignment:
| Q |
9 |
gagatgaaagaaagaagaacctgatctagga-ttgtatcaaacaccttgaaggcttgttcttcatcaagcagttttgtctgcgttggaccagtacaaacc |
107 |
Q |
| |
|
|||| ||||||||||| ||||||||||| || |||||||||||||||||||||||||||||||||||||| |||| || ||||||||||||||||||||| |
|
|
| T |
29170188 |
gagacgaaagaaagaaaaacctgatctaagaattgtatcaaacaccttgaaggcttgttcttcatcaagcggtttggtttgcgttggaccagtacaaacc |
29170287 |
T |
|
| Q |
108 |
ctggtttgagcatccaacgccgtttgatttggcctagtcaatttcgaactccgataccaagacgacaatgaaggattctgaacgtcgaattcc |
200 |
Q |
| |
|
|||||||||||||||||| | |||||||| ||||||||||||||||||||||||||| |||||||||| ||||||||| ||| |||||||||| |
|
|
| T |
29170288 |
ctggtttgagcatccaacacagtttgattcggcctagtcaatttcgaactccgatacgaagacgacaacgaaggattccgaaagtcgaattcc |
29170380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University