View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5824_high_31 (Length: 293)
Name: NF5824_high_31
Description: NF5824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5824_high_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 121 - 283
Target Start/End: Original strand, 48448443 - 48448605
Alignment:
| Q |
121 |
atctggtttcgaattgagaaaacatgagtcactatgacacttctaatggaagctgcgtcgggtgtcgtcactgatacatttcattgcattcaattaattc |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
48448443 |
atctggtttcgaattgagaaaacatgagtcactatgacacttctaatggaagccgcgtcgggtgtcgtcactgacacatttcattgcattcaattaattc |
48448542 |
T |
|
| Q |
221 |
attttttcaaaatttgatccgtgctgacgtgtcctgtcagtgtgtccggtgtctgtgtctgtg |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48448543 |
attttttcaaaatttgatccgtgctgacgtgtcctgtcagtgtgtccggtgtctgtgtctgtg |
48448605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University