View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5824_high_42 (Length: 242)
Name: NF5824_high_42
Description: NF5824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5824_high_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 17 - 226
Target Start/End: Complemental strand, 48674846 - 48674637
Alignment:
| Q |
17 |
aagtataacatcattggtaagcaacgaaacatcttcaatcttacgttgaaccataagtttaatagttccatcaactccttcaagtgcatgatcacatata |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48674846 |
aagtataacatcattggtaagcaacgaaacatcttcaatcttacgttgaaccataagtttaatagttccatcaactccttcaagtgcatgatcacatata |
48674747 |
T |
 |
| Q |
117 |
acattataagttaacacaacatccatcacattttgcaatgtctcggttccccaagacatagaaggccatgaattttccattttttctacttccataagaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48674746 |
acattataagttaacacaacatccatcacattttgcaatgtctcggttccccaagacatagaaggccatgaattttccattttttctacttccataagaa |
48674647 |
T |
 |
| Q |
217 |
cattgttcat |
226 |
Q |
| |
|
|||||||||| |
|
|
| T |
48674646 |
cattgttcat |
48674637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University