View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5824_high_52 (Length: 209)
Name: NF5824_high_52
Description: NF5824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5824_high_52 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 24 - 194
Target Start/End: Complemental strand, 26234082 - 26233912
Alignment:
| Q |
24 |
ataagactaatccaaaaccttataaactctatgaatcaccaactgaaatagcttggcctgaaattcccaacggtgaccgcgaaattcgtcgtgaaatctc |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26234082 |
ataagactaatccaaaaccttataaactctatgaatcaccaactgaaatagcttggcctgaaattcccaacggtgaccgcgaaattcgtcgcgaaatctc |
26233983 |
T |
|
| Q |
124 |
ccttagaacaggtcttatctcaggcttaccaggtgaccaatcaaatattttttctgattcttgcttgatct |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26233982 |
ccttagaacaggtcttatctcaggcttaccaggtgaccaatcaaatattttctctgattcttgcttgatct |
26233912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University