View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5824_low_35 (Length: 277)
Name: NF5824_low_35
Description: NF5824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5824_low_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 77; Significance: 8e-36; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 108 - 201
Target Start/End: Original strand, 43425829 - 43425918
Alignment:
| Q |
108 |
tagtacccccgattaatatatattaagtgcatcactccaagttatcaactaatggctaatatataagggtgaattagaaaaatcactactcatc |
201 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43425829 |
tagtacccccgattaatat----taagtgcatcactccaagttatcaactaatggctaatatataagggtgaattagaaaaatcactactcatc |
43425918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 210 - 257
Target Start/End: Original strand, 43425942 - 43425989
Alignment:
| Q |
210 |
cttaatttgtgagaaatgatcaattttgagagttattgtggggactta |
257 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43425942 |
cttaatttgtgagaaatgatcaattgtgagagttattgtggggactta |
43425989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 24 - 60
Target Start/End: Original strand, 43425745 - 43425781
Alignment:
| Q |
24 |
aataataactttgaaaaaacaaaataaagtatgtcac |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43425745 |
aataataactttgaaaaaacaaaataaagtatgtcac |
43425781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University