View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5824_low_48 (Length: 238)
Name: NF5824_low_48
Description: NF5824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5824_low_48 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 17260153 - 17259922
Alignment:
| Q |
1 |
tctaagattcattcttttgttggcttttgcatcttcgatttcttcttttgaaccccaaatgggatcaacccgtgtcgtctttcaggttttctttatcgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || |
|
|
| T |
17260153 |
tctaagattcattcttttgttggcttttgcatcttcgatttcttcttttgaaccccaaatgggatcaacccgtgttgtctttcaggttttctttatcaaa |
17260054 |
T |
 |
| Q |
101 |
atttcttcannnnnnnnacttttgattgtttcaatttgtagtataagtttaatgcttgagtggtatttaatctatttatctgtactttgttaagtccttg |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17260053 |
atttcttcattttttttacttttgattgtttcaatttgtagtaaaagtttaatgcttgagtggtatttaatctatttatctgtactttgttaagtccttg |
17259954 |
T |
 |
| Q |
201 |
aatgattgaaaagcttaaactgtagaccccat |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
17259953 |
aatgattgaaaagcttaaactgtagaccccat |
17259922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University