View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5824_low_51 (Length: 233)
Name: NF5824_low_51
Description: NF5824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5824_low_51 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 21 - 214
Target Start/End: Original strand, 8375265 - 8375458
Alignment:
| Q |
21 |
ggcagatggtgaggtcatgcccttggaatgggttctatgcggtggcttcccaagaatctgttgcaactttaatttctgtttcttcttcttggataagacg |
120 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
8375265 |
ggcagatggtgagctcacgcccttggaatgggttctatgcggtggcttcccaagaatctgttgcagttttaatttctgtttcttcttcttgaataagacg |
8375364 |
T |
 |
| Q |
121 |
ggtgtgaaaggagcttaaactaatttcttatcatactctttgattcattgccataggtccatgtcttgttgaattattggattgttgtgttgtt |
214 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8375365 |
ggtgtgaaaggagcttcagctaatttcttatcatactctttgattcattgccataggtccatgtcttgttgaattattggattgttgtgttgtt |
8375458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University