View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5824_low_52 (Length: 226)
Name: NF5824_low_52
Description: NF5824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5824_low_52 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 14 - 210
Target Start/End: Complemental strand, 32506989 - 32506796
Alignment:
| Q |
14 |
agatgaagaaggtgacacattattatgagatttccttgaacctacaagcctaggcaaaatggtaaaaaatatgttgttgacttttgaatttcttctctta |
113 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32506989 |
agatgaagaaggtgacacattat---gagatttccttgaacctacaagcctaggcaaaatggtaaaaaatatgttgttgacttttgaatttcttctctta |
32506893 |
T |
|
| Q |
114 |
ccattggacttgtaattagtactagaatatgaaggtggaggtgtgagaggaggcagagaagtttctgacaaaggatgtttaggtgttcctggttgtg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32506892 |
ccattggacttgtaattagtactagaatatgaaggtggaggtgtgagaggaggcagagaagtttctgacaaaggatgtttaggtgttcctggttgtg |
32506796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University