View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5825_low_11 (Length: 290)
Name: NF5825_low_11
Description: NF5825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5825_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 13 - 272
Target Start/End: Original strand, 48268242 - 48268501
Alignment:
| Q |
13 |
agaatatgatggaggagtatgggaaattggtcgagagatctcctgatggttctgctaaattgagggnnnnnnngtttccgattttggaggttgatgttac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||| ||||||||||||||| |
|
|
| T |
48268242 |
agaatatgatggaggagtatgggaaattggtcgagagatctcctgatggttctgctaaattgagggtttttttgtttccgttttcggaggttgatgttac |
48268341 |
T |
 |
| Q |
113 |
cggtggagagcagcttggggatttgcaggatacggggcagaagtattttgatgctgtgaatggtcttgttgatgggaatggggtggtttgtggcgggttc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48268342 |
cggtggagagcagcttggggatttgcaggatacggggcagaagtattttgatgctgtgaatggtcttgttgatgggaatggggtggtttgtggtgggttc |
48268441 |
T |
 |
| Q |
213 |
aagagtaaggagagtgttactagtgcggcttcaacacaaaattctgatttgagtgggata |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48268442 |
aagagtaaggagagtgttactagtgcggcttcaacacaaaattctgatttgagtgggata |
48268501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University