View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5829-Insertion-5 (Length: 147)
Name: NF5829-Insertion-5
Description: NF5829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5829-Insertion-5 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 82 - 147
Target Start/End: Original strand, 7174083 - 7174148
Alignment:
| Q |
82 |
tatactcattaatcgaagtgtgatttgtttttggaattgaatttgattatgggagatatactaact |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7174083 |
tatactcattaatcgaagtgtgatttgtttttggaattgaatttgattatgggagatatactaact |
7174148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 5e-17
Query Start/End: Original strand, 9 - 53
Target Start/End: Original strand, 7174015 - 7174059
Alignment:
| Q |
9 |
tgtagtaataattctactggaaatttggaatggcaaattcacgtg |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7174015 |
tgtagtaataattctactggaaatttggaatggcaaattcacgtg |
7174059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University