View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5829-Insertion-7 (Length: 137)

Name: NF5829-Insertion-7
Description: NF5829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5829-Insertion-7
NF5829-Insertion-7
[»] chr2 (1 HSPs)
chr2 (9-137)||(5130300-5130427)


Alignment Details
Target: chr2 (Bit Score: 85; Significance: 7e-41; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 85; E-Value: 7e-41
Query Start/End: Original strand, 9 - 137
Target Start/End: Original strand, 5130300 - 5130427
Alignment:
9 atctgggatcgtcgaaattgtgaccgcagagagtccaaatctcaaaaactaaggttaattaattgctatgcgcacctattctaatgtactaatgttaatg 108  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | | ||||| |||| |||  |||||||||||||| ||||    
5130300 atctgggatcgtcgaaattgtgaccgcaaagagtccaaatctcaaaaactaaggttaatt-actactatgtgcacatatagtaatgtactaatgtgaatg 5130398  T
109 taaattcattacctgagaagtgctgatct 137  Q
    ||||||| |||||||||||||||||||||    
5130399 taaattcgttacctgagaagtgctgatct 5130427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University