View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5829-Insertion-7 (Length: 137)
Name: NF5829-Insertion-7
Description: NF5829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5829-Insertion-7 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 85; Significance: 7e-41; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 7e-41
Query Start/End: Original strand, 9 - 137
Target Start/End: Original strand, 5130300 - 5130427
Alignment:
| Q |
9 |
atctgggatcgtcgaaattgtgaccgcagagagtccaaatctcaaaaactaaggttaattaattgctatgcgcacctattctaatgtactaatgttaatg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | | ||||| |||| ||| |||||||||||||| |||| |
|
|
| T |
5130300 |
atctgggatcgtcgaaattgtgaccgcaaagagtccaaatctcaaaaactaaggttaatt-actactatgtgcacatatagtaatgtactaatgtgaatg |
5130398 |
T |
|
| Q |
109 |
taaattcattacctgagaagtgctgatct |
137 |
Q |
| |
|
||||||| ||||||||||||||||||||| |
|
|
| T |
5130399 |
taaattcgttacctgagaagtgctgatct |
5130427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University