View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5829_high_16 (Length: 241)
Name: NF5829_high_16
Description: NF5829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5829_high_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 17 - 227
Target Start/End: Original strand, 1517057 - 1517271
Alignment:
| Q |
17 |
aattaatgcgttcaagatgatgtagaaagaaaggcaaattgtattgttcttctaagagcaatgctatttacattatttatcacaaaatctatttatacaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1517057 |
aattaatgcgttcaagatgatgtagaaagaaaggcaaattgtattgttcttctaagagcaatgctatttacattatttatcacaaaatctattgatacaa |
1517156 |
T |
|
| Q |
117 |
aacatgcataactcgttattttttctggaagatgcttgatag----atttctagagagggctaatgtatatgagaaattttatggttctgtgaagaaaaa |
212 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1517157 |
aacatgcataagtcgttgttttttctggaagatgcttgatagattaatttcaagagagggctaatgtatatgagaaattttatggttctgtgaagaaaaa |
1517256 |
T |
|
| Q |
213 |
gaaaaatgggatatt |
227 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
1517257 |
gaaaaatgggatatt |
1517271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University