View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5829_low_13 (Length: 249)
Name: NF5829_low_13
Description: NF5829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5829_low_13 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 73 - 249
Target Start/End: Complemental strand, 24797798 - 24797622
Alignment:
| Q |
73 |
ttatctctaaatatgtcattttccaagttgcaaggtatatttatttaacaacatacatttttcaattccttgtgtcattcatactggattgaatttatgt |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24797798 |
ttatctctaaatatgtcattttccaagttgcaaggtatatttatttaaccacatgcatttttcaattccttgtgtcattcatactggattgaatttatgt |
24797699 |
T |
 |
| Q |
173 |
gcagtcgaaaaatgatgttgtcatgcaatcagtaggttcgagatcgtctgatcaacaattcatatttcaaccttttt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24797698 |
gcagtcgaaaaatgatgttgtcatgcaatcagtaggttcgagatcgtctgatcaacaattcatatttcaaacttttt |
24797622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University