View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5829_low_14 (Length: 248)
Name: NF5829_low_14
Description: NF5829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5829_low_14 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 71 - 248
Target Start/End: Original strand, 22314133 - 22314310
Alignment:
| Q |
71 |
tgtttcccacatatggcaaatggtcaagattcacattttttaatctcatttatcggagacaaaatatgtttgctagtgttcgctcagatcgactataggt |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22314133 |
tgtttcccacatatggcaaatggtcaagattcacattttttaatctcacttattggagaaaaaatatgtttgctagtgttcgctcagatcgactataggt |
22314232 |
T |
 |
| Q |
171 |
gtttctgacataacaagttaagccttatcttgacaaaccatttgtgaggttagcataatactaaatttggtgatggtc |
248 |
Q |
| |
|
|| |||||||| |||||||||| |||||||||||||| ||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
22314233 |
gtctctgacatgacaagttaaggtttatcttgacaaactatttgtgaggttagcatgatactgaatttggtgatggtc |
22314310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University