View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5830-Insertion-3 (Length: 150)
Name: NF5830-Insertion-3
Description: NF5830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5830-Insertion-3 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 4e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 4e-70
Query Start/End: Original strand, 9 - 150
Target Start/End: Original strand, 53674333 - 53674474
Alignment:
| Q |
9 |
attttctcttaatcttaggaccagatgaaggtgtatatgtcatgcttgatgctctagtgctaaatgtgtcatcttctgtgctgttggattgtccccctag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53674333 |
attttctcttaatcttaggaccagatgaaggtgtatatgtcaagcttgatgctctagtgctaaatgtgtcatcttctgtgctgttggattgtccctctag |
53674432 |
T |
|
| Q |
109 |
tagtccatctagaagtactgttctaggtgaactgttctgttg |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53674433 |
tagtccatctagaagtactgttctaggtgaactgttctgttg |
53674474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University