View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5831-Insertion-5 (Length: 646)
Name: NF5831-Insertion-5
Description: NF5831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5831-Insertion-5 |
 | |
|
| [»] chr8 (3 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 272; Significance: 1e-152; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 355 - 646
Target Start/End: Original strand, 11612646 - 11612937
Alignment:
| Q |
355 |
agtgtatttatcaaaggataagcttacaagggttatcttagaaattgcttaatgttaaagattttgttatggttggttggtatgactgtgagagtggacc |
454 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11612646 |
agtgtatttatcaaaggataagcttaaaagggttacattagaaattgcttaatgttaaagattttgttatggttggttggtgtgactgtgagagtggacc |
11612745 |
T |
|
| Q |
455 |
tgttacagttcagctggtctttatcttcaacatgaagccttttttaattttcatgtttctatatagtttggtatgatgtaatctagcttctgcttttgtc |
554 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612746 |
tgttacagttcagctggtctttatcttcaacatgaagccttttttaattttcatgtttctatatagtttggtatgatgtaatctagcttctgcttttgtc |
11612845 |
T |
|
| Q |
555 |
ctcactctaattgattttgtaaattatttccattgatctagtttcttctgcatgtttggtttgccttttagtcttaaggtccttttcttttt |
646 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612846 |
ctcactctaattgattttgtaaagtatttccattgatctagtttcttctgcatgtttggtttgccttttagtcttaaggtccttttcttttt |
11612937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 137; E-Value: 3e-71
Query Start/End: Original strand, 89 - 229
Target Start/End: Original strand, 11612380 - 11612520
Alignment:
| Q |
89 |
tcatatgttagtactctcttctcttttttcatgtgtccctattgattcatagcactatctctttatttcttatgctttactatgctttgaggtgtgaaat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612380 |
tcatatgttagtactctcttctcttttttcatgtgtcactattgattcatagcactatctctttatttcttatgctttactatgctttgaggtgtgaaat |
11612479 |
T |
|
| Q |
189 |
atcttttactgcttttcacttaattcaccaaagttcttacc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612480 |
atcttttactgcttttcacttaattcaccaaagttcttacc |
11612520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 9 - 57
Target Start/End: Original strand, 11612290 - 11612338
Alignment:
| Q |
9 |
tttatcacaatcacaattcacaattcagaataccctcttgagttttgat |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612290 |
tttatcacaatcacaattcacaattcagaataccctcttgagttttgat |
11612338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University