View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5831_high_26 (Length: 224)
Name: NF5831_high_26
Description: NF5831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5831_high_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 17 - 207
Target Start/End: Complemental strand, 562846 - 562656
Alignment:
| Q |
17 |
atcgtaattaaattgtttttgaggtaaagctatatgaaagcagataaaatatgattatattttcatctcctaaatgcatttaacaaatattatataagaa |
116 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
562846 |
atcgttattaaattatttttgaggtaaagctatatgaaagcagataaaatatgattattttttcatctccttaatgcatttaacaaacattatataagaa |
562747 |
T |
|
| Q |
117 |
tgtgtatgacgtttttagcttaaatatatgaccggaaagaatatcatattcgcttctaattatatggttgagctaagaacatgatccatat |
207 |
Q |
| |
|
||||||| || |||||||||||||||||||| ||||||||||||||||||||||| |||||||||| ||||||||||||| ||||||||| |
|
|
| T |
562746 |
tgtgtataacatttttagcttaaatatatgatcggaaagaatatcatattcgcttataattatatgtttgagctaagaacgcgatccatat |
562656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University