View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5831_low_14 (Length: 305)
Name: NF5831_low_14
Description: NF5831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5831_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 14 - 290
Target Start/End: Complemental strand, 40078160 - 40077884
Alignment:
| Q |
14 |
atatgaaataacattacatgtgttgaaagagataattcattttagatggttctgatttatgtccaagatgtggagaccgtccaaagactttgattcatcc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40078160 |
atatgaaataacattacatgtgttgaaagagataattcattttagatggttctgatttatgtccaagatgtggagaccgtccaaagactttgattcatcc |
40078061 |
T |
 |
| Q |
114 |
tttggaattgtgaagaagaagtcaaaatgttttggactgaactaataaacccaaatatttaggctgagattttttgcattgcctttcatgattggtttac |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40078060 |
tttggaattgtgaagaagaagtcaaaatgttttggactgaactaataaatccaaatatttaggctgagatcttttgcattgcctttcatgattggtttac |
40077961 |
T |
 |
| Q |
214 |
ttggaatctctttgttactaccattggctgctaaactatgaattgaatgtaccactttctttggagttgtaactttt |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40077960 |
ttggaatctctttgttactaccattggctgctaaactatgaattgaatgtaccactttctttggagttgtaactttt |
40077884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University