View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5831_low_17 (Length: 267)
Name: NF5831_low_17
Description: NF5831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5831_low_17 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 9 - 267
Target Start/End: Complemental strand, 45461154 - 45460896
Alignment:
| Q |
9 |
gaaaagaaagctgggattcctgctactatgtctgtgtaaatgaacccaattccagctacccttgaaatcccaaggcctggactgacatctattagccatt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45461154 |
gaaaagaaagctgggattcctgctactatgtctgtgtaaatgaacccaattccagctacccttgaaatcccaaggcctggactgacatctattagccatt |
45461055 |
T |
|
| Q |
109 |
cagttgacaccttgttttgcaaatcaaactcatacttcttcactgttccataatgccatgaaagcatgactgtcatcgacacaaccaaaaggacaactag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45461054 |
cagttgacaccttgttttgcaaatcaaactcatacttcttcactgttccataatgccatgaaagcatgactgtcatcgacacaaccaaaaggacaactag |
45460955 |
T |
|
| Q |
209 |
ataccaagctcccttgtgaaattgcagcatacacgccgaaaaatatgcaacctcaacga |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45460954 |
ataccaagctcccttgtgaaattgcagcatacacgccgaaaaatatgcaacctcaacga |
45460896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University