View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5831_low_19 (Length: 254)
Name: NF5831_low_19
Description: NF5831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5831_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 7464557 - 7464322
Alignment:
| Q |
1 |
tacaatcttgtgattactacttgtagaactagcggccatatatcagaagcttcatccacttagttcaaaagtcaagtacaacacctcaagacacaagcca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7464557 |
tacaatcttgtgattactacttgtagaactagcagccatatatcagaagcttcatctacctagttcaaaagtcaagtacaacacctcaagacacaagcca |
7464458 |
T |
|
| Q |
101 |
atttaacaatcacacgttaaaaaatggaagttatgaaaacaaccacggggatgcctaaannnnnnnnnnnnngctccccaaggtatcattgagtcggaag |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
7464457 |
atttaacaatcacaggttaaaaaatggaagttatgaaaacaacca-tgggatgcctaaattattattcttttgctccccaaggtatgattgagtcggaag |
7464359 |
T |
|
| Q |
201 |
ttagagattaatcttttgacatacaaagactcgttta |
237 |
Q |
| |
|
||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
7464358 |
ttaaagactaatcttttgacatacaaagactcgttta |
7464322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University