View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5831_low_22 (Length: 234)
Name: NF5831_low_22
Description: NF5831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5831_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 108 - 219
Target Start/End: Complemental strand, 4228851 - 4228739
Alignment:
| Q |
108 |
aatttgataaatcactcacatgtcttatgcttaagtttctatgtttggaaaatcaaagaaaattatgatttg-ttatactggattgaattaggtgcctgt |
206 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4228851 |
aattcgataaatcactcccatgtcttatgcttaagtttctatgttttgaaaatcaaagaaaattatgatttgtttatactggattgaattaggtgcctgt |
4228752 |
T |
|
| Q |
207 |
gcagtagataagt |
219 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4228751 |
gcagtagataagt |
4228739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 14 - 76
Target Start/End: Complemental strand, 4228945 - 4228883
Alignment:
| Q |
14 |
agagaagaatctcaatttttctattgtttgattcccaattcaacctagaaatgagttcaggta |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4228945 |
agagaagaatctcaatttttctattgtttgattcccaattcaacctagaaatgagttcaggta |
4228883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 108 - 191
Target Start/End: Original strand, 52618784 - 52618867
Alignment:
| Q |
108 |
aatttgataaatcactcacatgtcttatgcttaagtttctatgtttggaaaatcaaagaaaattatgatttgttatactggatt |
191 |
Q |
| |
|
|||||||||||||||||| |||||| ||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52618784 |
aatttgataaatcactcatatgtctcatggttaagtttctatgttttgaaaatcaaagaaaattatgatttgttatactggatt |
52618867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 14 - 76
Target Start/End: Original strand, 52618689 - 52618751
Alignment:
| Q |
14 |
agagaagaatctcaatttttctattgtttgattcccaattcaacctagaaatgagttcaggta |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52618689 |
agagaagaatctcaatttttctattgtttgattcccaattcaacctagaaatgagttcaggta |
52618751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University