View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5831_low_23 (Length: 234)
Name: NF5831_low_23
Description: NF5831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5831_low_23 |
 |  |
|
| [»] scaffold0446 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 56066879 - 56067076
Alignment:
| Q |
1 |
caaatttatcttattttgcatttaccaaacaggaaaagcttgctgggacaacaaaatctaccccaaatacaatgaaaaaataggatccggtgcagttcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |||||||| ||||||||| |||||||| ||| ||||||||| |
|
|
| T |
56066879 |
caaatttatcttattttgcatttaccaatcaggaaaagcttgctggtacaacaaa------------tacaatgaacaaataggaaccgttgcagttcat |
56066966 |
T |
 |
| Q |
101 |
tttgaaaaaataatatcactgnnnnnnnnnnnnnnnatgcacgttttaatcaaaaacactaacatgtgactaattttaacaacgtaacatctcattgtat |
200 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
56066967 |
tttgaaaatataatatcactgccccccc--------atgcacgttttaatcaaaaacactaacatctgactaattttaacaacgtaacatctcattgtat |
56067058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0446 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0446
Description:
Target: scaffold0446; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 1436 - 1482
Alignment:
| Q |
1 |
caaatttatcttattttgcatttaccaa-acaggaaaagcttgctgg |
46 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1436 |
caaatttatcttattttgcatttaccaatccaggaaaagcttgctgg |
1482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University