View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5831_low_24 (Length: 232)
Name: NF5831_low_24
Description: NF5831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5831_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 15 - 217
Target Start/End: Complemental strand, 9251452 - 9251250
Alignment:
| Q |
15 |
caaaggaaaaacggccactaattgaaactaggaccaataaggaagcatatgcacgattatcccaatagaggtggaaaaataggctataatgcttgatttg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
9251452 |
caaaggaaaaacggccactaattgaaactaggaccaataaggaagcatatgcacgattatcccattagaggtggaaaaataggctaccatgcttgatttg |
9251353 |
T |
 |
| Q |
115 |
ggctaacaagcaaaaatagggtaccatgcttgctatgaaacaatttggagccatcattggaggcgtacaccaatggcactcgcgagatttcaatggaatt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9251352 |
ggctaacaagcaaaaatagggtaccatgcttgctaggaaacaatttggagccatcattggaggcgtacaccaatggcactcgcgagatttcaatggaatt |
9251253 |
T |
 |
| Q |
215 |
tct |
217 |
Q |
| |
|
||| |
|
|
| T |
9251252 |
tct |
9251250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University