View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5832_low_10 (Length: 251)
Name: NF5832_low_10
Description: NF5832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5832_low_10 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 8 - 251
Target Start/End: Complemental strand, 36421537 - 36421282
Alignment:
| Q |
8 |
cgaagaatatattaacttattttaaaaaaccgggttataaaatatacatctatgaaaatatgatggtttctttttgaaagatgctgtaaaacttatttac |
107 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36421537 |
cgaaaaatatattaacttattttaaaaaaccgggttataaaatatacatctatgaaaatatgatggtttctttttgaaagatggtgtaaaacttatttac |
36421438 |
T |
|
| Q |
108 |
acggttggtttatatctattaaactcttttctatgtgaaatttaatttttacattgttattttgataatgattaattatatttgcaatagaag------- |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
36421437 |
acggttggtttatatctattaaactcttttctatgtgaaatttaatttttacattgttattttgataatg----attatatttgtaatagaagtatttat |
36421342 |
T |
|
| Q |
201 |
----------taatattgaatgacaaagaacccactagggttggtctgatggtattagatt |
251 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36421341 |
tagtaggttttaatattgaatgacaaagaa-ccactagggttggtctgatggtattagatt |
36421282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 47 - 155
Target Start/End: Complemental strand, 36414127 - 36414022
Alignment:
| Q |
47 |
aaatatacatctatgaaaatatgatggtttctttttgaaagatgctgtaaaacttatttacacggttggtttatatctattaaactcttttctatgtgaa |
146 |
Q |
| |
|
|||||||||| |||| |||| ||||||||||||||||| || |||||||| ||||||| |||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
36414127 |
aaatatacatacatgacaatacgatggtttctttttgaacgacagtgtaaaacatatttacgcggttggtttatat---ttaaactctttcctatgtgaa |
36414031 |
T |
|
| Q |
147 |
atttaattt |
155 |
Q |
| |
|
|| |||||| |
|
|
| T |
36414030 |
atataattt |
36414022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University