View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5832_low_9 (Length: 290)
Name: NF5832_low_9
Description: NF5832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5832_low_9 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 9e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 113 - 290
Target Start/End: Complemental strand, 1582718 - 1582543
Alignment:
| Q |
113 |
caactttgcaagataaataatcaactgctagtaatttgtccaaaaataaccatgctacaataatgactgtggtgaatgaatgggtgatgttttaattttn |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
1582718 |
caactttgcaagataaataatcaactgctagtaatttgtccaaaaataaccatgctacaataatgac--tggtgtatgaatgggtgatgttttaatttta |
1582621 |
T |
 |
| Q |
213 |
nnnnnnntaattataattgttaccacaaaagctagcttcaaatttagaataaatcattcatatagtctctaaaatctc |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1582620 |
aaaaaaataattataattgttaccacaaaagctagcttcaaatttagaataaatcattcatatagtctctaaaatctc |
1582543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 13 - 56
Target Start/End: Complemental strand, 1582816 - 1582773
Alignment:
| Q |
13 |
aatatacagcgagttaaataaaaggaataacaaagcatcataac |
56 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1582816 |
aatatacagcgagttaaataagaggaataacaaagcatcataac |
1582773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University