View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5834-Insertion-12 (Length: 117)
Name: NF5834-Insertion-12
Description: NF5834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5834-Insertion-12 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 3e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 9 - 117
Target Start/End: Original strand, 39555019 - 39555127
Alignment:
| Q |
9 |
cgactgttgctgctaggacacgaagtcgaatgcaggtgtttgggatggctggtttggtttctgttttctgtgctgtagctgaatattctagaacatgaag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39555019 |
cgactgttgctgctaggacacgaagtcgaatgcaggtgtttgggatggctggtttggtttctgttttctgtgctgtagctgaatattctagaacatgaag |
39555118 |
T |
 |
| Q |
109 |
tgcatttgt |
117 |
Q |
| |
|
||||||||| |
|
|
| T |
39555119 |
tgcatttgt |
39555127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University