View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5834_high_14 (Length: 283)
Name: NF5834_high_14
Description: NF5834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5834_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 38299524 - 38299789
Alignment:
| Q |
1 |
tccgattgcgcggtagatttactggactctgataacgagacaatggagcaaaagatatcacggttagtaaaaacttgtgcatccatgatcctttcatctg |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38299524 |
tccgattgcgaggtagatttactggactctgatgacgagacaatggagcaaaaggaatcacggttagtaaaaacttgtgcatccatgatcctttcatctg |
38299623 |
T |
 |
| Q |
101 |
attattcctttcgtcattgcgagtacgactcaatgaagaacatcatggagtggttatgtcaagatattgttttgcctcctcctgacgttgtcgagcttta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38299624 |
attattcctttcgtcattgcgagtacgactcaatgaagaacatcatggaatggttaagtcaagatattgttttgcctcctcctgacgttgtcgagcttta |
38299723 |
T |
 |
| Q |
201 |
ttttgaggatttgtacactgaagagaaactcaatattaaacaacagctggctactattcctaatag |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38299724 |
ttttgaggatttgtacactgaagagaaactcaatattaaacaacagctggctactattcctaatag |
38299789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University