View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5834_high_24 (Length: 227)
Name: NF5834_high_24
Description: NF5834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5834_high_24 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 32882030 - 32881803
Alignment:
| Q |
1 |
tacatgaagtatatggattaattttgagatggagtgttgggagagaaaagaaaaggtaacggaagtagttagttattgtggtgagacgaactcgaaggaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32882030 |
tacatgaagtatatggattaattttgagatggagtgttgggagagaaaagaaaaggtaacggaagtagtcagttattgtggtgagacgaactcgaaggaa |
32881931 |
T |
 |
| Q |
101 |
gaaggttcaatgaaatgagatgcgattttaaataagatgaagttggttgagagaatataataactattatgattatgatgattgattgactggtcttac- |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32881930 |
gaaggttcaatgaaatgagatgcgattttaaataagatgaagttggttgagaga--ataataactattatgattatgatgattgattgactggtcttact |
32881833 |
T |
 |
| Q |
200 |
--ttttttggattgagggggatatggggtt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
32881832 |
ttttttttggattgagggggatatggggtt |
32881803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University