View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5834_low_15 (Length: 252)
Name: NF5834_low_15
Description: NF5834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5834_low_15 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 19 - 252
Target Start/End: Original strand, 521473 - 521708
Alignment:
| Q |
19 |
aaggggctatatagtggtgcactccatcaatgtggagaggtaatatagcattcttcaattgtaaaatgaaggatgttat--cttgtgttgaaaaaactga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
521473 |
aaggggctatatagtggtgcactccatcaatgtggagaggtaatatagcattcttcaattgtaaaatgaaggatgttatatcttgtgttgaaaaaactga |
521572 |
T |
 |
| Q |
117 |
gattaaatgctgtttctttgcaacactacaaatagttcttctaaaatattaattggtgaatgcagggtcatgaaccatttgtttcatatgaaggtcttga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
521573 |
gattaaatgctgtttctttgcaacactacaaatagttcttctaaaatattaattggtgaatgcagggtcatgaaccatttgtttcatatgaaggtcttga |
521672 |
T |
 |
| Q |
217 |
acagctgcaccggtttttatttgttctcgggatcac |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
521673 |
acagctgcaccggtttttatttgttctcgggatcac |
521708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 179 - 252
Target Start/End: Original strand, 8826866 - 8826939
Alignment:
| Q |
179 |
cagggtcatgaaccatttgtttcatatgaaggtcttgaacagctgcaccggtttttatttgttctcgggatcac |
252 |
Q |
| |
|
|||||||||||| |||||| ||| |||||| ||||||| ||||| || || ||| | |||||||| |||||||| |
|
|
| T |
8826866 |
cagggtcatgaatcatttgcttcttatgaaagtcttgagcagcttcatcgctttgtgtttgttcttgggatcac |
8826939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University