View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5834_low_18 (Length: 249)
Name: NF5834_low_18
Description: NF5834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5834_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 521686 - 521783
Alignment:
| Q |
1 |
tttttatttgttctcgggatcactcatgttctgtatagttgtctcgctgttggtttagcaatgagcaaggtcagtcattaaaatgtccagtttattat |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
521686 |
tttttatttgttctcgggatcactcatgttctgtatagttgtctcgctgttggtttagcgatgagcaaggtcagtcattaaaatttccagtttattat |
521783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 135 - 240
Target Start/End: Original strand, 521813 - 521918
Alignment:
| Q |
135 |
attcaataagggtatctactagagttctatagaagaatgaacatgtttcgtatattttctacccattggaggaacttgaggtgtcaaagtgagttgcata |
234 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
521813 |
attcaatatgggtatctactagagttcaatagaagaatgaacatgtttcttatattttctacccattggtggaacttgaggtgtcaaagtgagttgcata |
521912 |
T |
 |
| Q |
235 |
gatttt |
240 |
Q |
| |
|
|||||| |
|
|
| T |
521913 |
gatttt |
521918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 44129500 - 44129545
Alignment:
| Q |
189 |
ttttctacccattggaggaacttgaggtgtcaaagtgagttgcata |
234 |
Q |
| |
|
||||||| ||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
44129500 |
ttttctaaccattggaggagcttgaggtggcaaagtgagttgcata |
44129545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 240
Target Start/End: Original strand, 5033206 - 5033261
Alignment:
| Q |
185 |
tatattttctacccattggaggaacttgaggtgtcaaagtgagttgcatagatttt |
240 |
Q |
| |
|
|||||||| ||| |||||||| |||||||| ||||||||||||||| || |||||| |
|
|
| T |
5033206 |
tatattttgtactcattggagtaacttgagatgtcaaagtgagttgtatcgatttt |
5033261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University