View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5834_low_19 (Length: 246)
Name: NF5834_low_19
Description: NF5834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5834_low_19 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 28 - 246
Target Start/End: Complemental strand, 32882551 - 32882333
Alignment:
| Q |
28 |
agatgccatttccgacgaggtcgttgatcttcaaatcaacaaccaccgccggctgttcccgatgacaaccgttgctatggctgtgactatgaatcggagc |
127 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32882551 |
agattccatttccgacgaggtcgttgatcttcaaatcaacaaccaccgccggctgttcccgctgacaaccgttgctatggctgtgactatgaatcggagc |
32882452 |
T |
|
| Q |
128 |
cgccgactcggatctaacagcgacggatggtggtggaggaggaggcatggtgaagtcagtgaacggagacggaggtttcaccggtgaagcttggtcggaa |
227 |
Q |
| |
|
|| ||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32882451 |
cggcgaatcggatctaacagcgacagatggtggtggaggaggaggcatggtgaagtcagtgaacggagacggaggtttcaccggcgaagcttggtcggaa |
32882352 |
T |
|
| Q |
228 |
atagcggagacgcagcaga |
246 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
32882351 |
atagcggagacgcagcaga |
32882333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University