View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5834_low_23 (Length: 238)
Name: NF5834_low_23
Description: NF5834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5834_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 4881730 - 4881947
Alignment:
| Q |
1 |
tctctaattgtgttaagtggcatctctattgtctttgaatgtgtaaaaattataaaagtatatgtgttcatcttttgttggtaatttcaattttaatgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4881730 |
tctctaattgtgttaagtggcatctctattgtctttgaatgtgtcaaaattacaaaagtatatgtgttcatcttttgttggtaatttcaatttcaatgga |
4881829 |
T |
 |
| Q |
101 |
tcaaattgactaatgaaagacatatttgatcaccaatttaaccattgaaagacacatccaaagaccaaactaactnnnnnnntaaagtacattcatgtat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| ||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
4881830 |
tcaaattgactaatgaaagacatatttgatcacgaatttaaccattcaaagacacattcaaagaccaaactaactaaaaaaataaaatacattcatgtat |
4881929 |
T |
 |
| Q |
201 |
gcttttgtaattttgaaa |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
4881930 |
gcttttgtaattttgaaa |
4881947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University