View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5834_low_25 (Length: 227)
Name: NF5834_low_25
Description: NF5834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5834_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 6 - 217
Target Start/End: Original strand, 27834843 - 27835054
Alignment:
| Q |
6 |
atctacaacacaacacgatctctcaaaatagttaaaatacagaagatcaaaatgacaatggttaatgtatttgaaatattttcagtctcatgaaattgac |
105 |
Q |
| |
|
||||||| ||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27834843 |
atctacagcacaacatcatctctcaaaatacttaaaatacagaagatcaaaatgacaatggttaatgtatttgaaatattttcagtctcatgaaattgac |
27834942 |
T |
 |
| Q |
106 |
aaaaattgcttttgaattctaccaaacttttatttgtctttagcgtatcaaaaaattatatgaaaagaaagatttacctttttcaatgaagattttttca |
205 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27834943 |
aaaaattgcttttgaattctaccaaatttttatttgtctttagcgtatcaaaaaattatatgaaaagaaagatttaccttttttaatgaagattttttca |
27835042 |
T |
 |
| Q |
206 |
atctcatgaaga |
217 |
Q |
| |
|
||||||||||| |
|
|
| T |
27835043 |
gtctcatgaaga |
27835054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 66 - 118
Target Start/End: Complemental strand, 28417818 - 28417766
Alignment:
| Q |
66 |
gttaatgtatttgaaatattttcagtctcatgaaattgacaaaaattgctttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28417818 |
gttaatgtatttgaaatattttcagtctaatgaaattgacaaaaattgctttt |
28417766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University