View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5835_high_4 (Length: 401)
Name: NF5835_high_4
Description: NF5835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5835_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 19 - 375
Target Start/End: Complemental strand, 37962548 - 37962199
Alignment:
| Q |
19 |
gtaactacgtggaagtgactagtactgggccccatgtgtcgtgttctcaggagcagttcacggtggaacagtggcttgcgactgatactagtccttatca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37962548 |
gtaactacgtggaagtgactagtactgggccccatgtgtcgtgttctcaggagcagttcacggtggaacagtggcttgcgactgatactagtccttatca |
37962449 |
T |
 |
| Q |
119 |
attgtggtctgtgaggaatctttgtcattataagctggatcaggcccgacccaaaaccggtccacctgttcatcatcgcaaaattggatctgagttttct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37962448 |
attgtggtctgtgaggaatctttgtcattataagctggatcaggcccgacccaaaaccggcgcacccgttcatcatcgcaaaattggatctgagttttct |
37962349 |
T |
 |
| Q |
219 |
attttggatgccccaattgtgcttgcgtgagatatgatttcaatctgttgttgtgtgtgttagttagttatcctttcttgttttggatagctcaatttgt |
318 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
37962348 |
attttggatgccccaattg----tgcgtgagatatgatttcaatctgttgttgtgtgtgttagttagttatcctttcttgttttggatacctgaatttgt |
37962253 |
T |
 |
| Q |
319 |
attgggggattcgggttttagggtcgataacccgtttgtgttttttcaataataata |
375 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37962252 |
att---ggattcgggttttagggtcgataacccgtttgtgttttttcaataataata |
37962199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University