View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5835_low_11 (Length: 208)
Name: NF5835_low_11
Description: NF5835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5835_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 12 - 188
Target Start/End: Original strand, 45966078 - 45966257
Alignment:
| Q |
12 |
gaagaaaatatcagcaccagcacctcttacttgaatccaatttgatggatagttaaatgaataaccatcaaatgtatcaacatattcacgaaacacacga |
111 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45966078 |
gaagaaaatatcagcaccagcacctcgtacttgaatccaatttgatggatagttaaatgaataaccatcaaatgtatcaacatattcacgaaacacacga |
45966177 |
T |
 |
| Q |
112 |
ggttgttgtgctaatgctgtaccaatgtcggagagaatgtatgt---tgataagattaatgatattgcttttcttctagg |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45966178 |
ggttgttgtgctaatgctgtaccaatgtcggagagaatgtatgttgatgataagattaatgatattgcttttcttctagg |
45966257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University