View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5835_low_6 (Length: 318)
Name: NF5835_low_6
Description: NF5835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5835_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 19 - 292
Target Start/End: Complemental strand, 37962465 - 37962199
Alignment:
| Q |
19 |
gatactagtccttatcaattgtggtctgtgaggaatctttgtcattataagctggatcaggcccgacccaaaaccggtccacctgttcatcatcgcaaaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
37962465 |
gatactagtccttatcaattgtggtctgtgaggaatctttgtcattataagctggatcaggcccgacccaaaaccggcgcacccgttcatcatcgcaaaa |
37962366 |
T |
|
| Q |
119 |
ttggatctgagttttctattttggatgccccaattgtgcttgcgtgagatatgatttcaatctgttgttgtgtgtgttagttagttatcctttcttgttt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37962365 |
ttggatctgagttttctattttggatgccccaattg----tgcgtgagatatgatttcaatctgttgttgtgtgtgttagttagttatcctttcttgttt |
37962270 |
T |
|
| Q |
219 |
tggatagctcaatttgtattgggggattcgggttttagggtcgataacccgtttgtgttttttcaataataata |
292 |
Q |
| |
|
|||||| || |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37962269 |
tggatacctgaatttgtatt---ggattcgggttttagggtcgataacccgtttgtgttttttcaataataata |
37962199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University