View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5836-Insertion-4 (Length: 573)
Name: NF5836-Insertion-4
Description: NF5836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5836-Insertion-4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 6e-88; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 6e-88
Query Start/End: Original strand, 17 - 294
Target Start/End: Complemental strand, 25544331 - 25544053
Alignment:
| Q |
17 |
caataatggtgtcaccattattttggaaattgaagcggtttttaacattgaatagtttcaacattgaactaatcaatgttnnnnnnncttttcaacctcc |
116 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||| |||||||||||||||||||| |||||||||||| |||||||| | |||||||||| |
|
|
| T |
25544331 |
caataatggagtcaccattattttggaaatggaagcgttttttaacattgaatagtttaaacattgaactattcaatgttaaaaaaacgattcaacctcc |
25544232 |
T |
|
| Q |
117 |
acaataatgacaccattattgctcattccgcggccgagagcttgaaacacagacacatctttgagatatgaagctagacaacggtctaattcaaaggaga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25544231 |
acaataatgacaccattattgctcattcggcggccgagagcttgaaacacagacgcatcttcgagatatgaagctagacaacggtctaattcaaaggaga |
25544132 |
T |
|
| Q |
217 |
tcttgctaatattgtnnnnnnnnnnntctctgcttagtatg-tttgcatttccaaaacgacaatattcgatttcgacaa |
294 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||||||| || ||||||||||| |
|
|
| T |
25544131 |
tcttgctaatattgtaaaaaaaaaaacctctgcttagtatgttttgcatttccaaaacgacaatctttgatttcgacaa |
25544053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 335 - 373
Target Start/End: Complemental strand, 25544056 - 25544018
Alignment:
| Q |
335 |
acaagctcatataacatgaacgaatcgtagttggataga |
373 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25544056 |
acaagctcatataacatgaacgaatcgtagtcggataga |
25544018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University