View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5836_high_15 (Length: 228)

Name: NF5836_high_15
Description: NF5836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5836_high_15
NF5836_high_15
[»] chr3 (1 HSPs)
chr3 (1-213)||(37386593-37386805)


Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 37386593 - 37386805
Alignment:
1 taactaaaatccgagtaacagttgttgcaattaattcgatatatcttcccatcacttccatcattaatttaccagagcttattgaccaatataacttggt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
37386593 taactaaaatccgagtaacagttgttgcaattaattcgatatatcttcccatcacttccatcattaatttaccagagctcattgaccaatataacttggt 37386692  T
101 taaatgtttgaaatattaatggaatcttggtttttaggtgaatgagttgttgggaatcataattatgtttttgagagcctagctagcctatacggtgaga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37386693 taaatgtttgaaatattaatggaatcttggtttttaggtgaatgagttgttgggaatcataattatgtttttgagagcctagctagcctatacggtgaga 37386792  T
201 gtaatgtgctttt 213  Q
    |||||||||||||    
37386793 gtaatgtgctttt 37386805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University