View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5836_high_15 (Length: 228)
Name: NF5836_high_15
Description: NF5836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5836_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 37386593 - 37386805
Alignment:
| Q |
1 |
taactaaaatccgagtaacagttgttgcaattaattcgatatatcttcccatcacttccatcattaatttaccagagcttattgaccaatataacttggt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37386593 |
taactaaaatccgagtaacagttgttgcaattaattcgatatatcttcccatcacttccatcattaatttaccagagctcattgaccaatataacttggt |
37386692 |
T |
 |
| Q |
101 |
taaatgtttgaaatattaatggaatcttggtttttaggtgaatgagttgttgggaatcataattatgtttttgagagcctagctagcctatacggtgaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37386693 |
taaatgtttgaaatattaatggaatcttggtttttaggtgaatgagttgttgggaatcataattatgtttttgagagcctagctagcctatacggtgaga |
37386792 |
T |
 |
| Q |
201 |
gtaatgtgctttt |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
37386793 |
gtaatgtgctttt |
37386805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University