View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5836_low_21 (Length: 227)
Name: NF5836_low_21
Description: NF5836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5836_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 21 - 218
Target Start/End: Complemental strand, 26438006 - 26437800
Alignment:
| Q |
21 |
ggtgactcaacatgacaaagcaatgattgaagaagagcaattgccggcaattctcatgcc------------ctccgactgcgagctcctctgcggggag |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26438006 |
ggtgactcaacatgacaaagcaatgattgaaga---gcaattgccggcaattctcatgccactgtccagcacctccgactgcgagctcctctgcggggag |
26437910 |
T |
 |
| Q |
109 |
gactcgtcggaggtcctcaccggagatttaccggaatgctcctccgacctggattcatcatcatcatcgcagttgccgtcgtcgtcattatttgccgagg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26437909 |
gactcgtcggaggtcctcaccggagatttaccggaatgctcctccgacctggattcatcatcatcatcgcagttgccgtcgtcgtcattatttgccgagg |
26437810 |
T |
 |
| Q |
209 |
aagaggagga |
218 |
Q |
| |
|
|||||||||| |
|
|
| T |
26437809 |
aagaggagga |
26437800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University