View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5837_low_9 (Length: 240)
Name: NF5837_low_9
Description: NF5837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5837_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 24 - 221
Target Start/End: Original strand, 29847519 - 29847716
Alignment:
| Q |
24 |
ctcttccattgtccatgaaaaactcattaccaataccaacaccaccactatcatcaagcgtttcttcaacccttatggctcagcagcatacaacttcatc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29847519 |
ctcttccattgtccatgaaaaactcattaccaataccaacaccaccactatcatcaagcgtttcttcaacccttatggctcagcagcatacaacttcatc |
29847618 |
T |
 |
| Q |
124 |
acaatgagtgcttatagaggtggactcaacacttttgctatcactggtctttcttcaaagcctcttcatgtttatggaaatcctacttatgaatgtga |
221 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29847619 |
acaatgagtgcttatagaggtggacttaacacttttgctatcactggtctttcttcaaagcctcttcatgtttatggaaatcctacttatgaatgtga |
29847716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University