View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5838-Insertion-10 (Length: 181)
Name: NF5838-Insertion-10
Description: NF5838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5838-Insertion-10 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 10 - 181
Target Start/End: Original strand, 28454020 - 28454191
Alignment:
| Q |
10 |
ggaaagtgtaacaacacgagttgtcccgtggatctaaacatggggtgtccaacgaagttgaaggtgacacaaaatgggacagttgtggcatgtaaaagtt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28454020 |
ggaaagtgtaacaacacgagttgtcccgtggatctaaacacggggtgtccaacgaagttgaaggtgacacaaaatggaacagttgtggcatgtaaaagtt |
28454119 |
T |
|
| Q |
110 |
cttgtcggggaaattgtaacgagacaagtgcagatgttaatgttaagatattcaagacggcgtgccctcaag |
181 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28454120 |
cttgttggggaaattgtaacgagacaagtgcagatgttaatgttaagatattcaagacggcgtgccctcaag |
28454191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University