View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5838-Insertion-7 (Length: 217)
Name: NF5838-Insertion-7
Description: NF5838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5838-Insertion-7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 9 - 114
Target Start/End: Original strand, 53288873 - 53288982
Alignment:
| Q |
9 |
ctaattaaacgaaataaattaaaagattaatcgtttttctctcttaataattg----atggataatttttaaaaaatagaatgtataccatttgccaaat |
104 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
53288873 |
ctaattaaacgaaaaaaattaaaagattaatcatttttctctcttaataattgattgatggataatttaaaaaaaatagaatgtataccatttgccaaat |
53288972 |
T |
|
| Q |
105 |
ttaatgcaaa |
114 |
Q |
| |
|
|||||||||| |
|
|
| T |
53288973 |
ttaatgcaaa |
53288982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University