View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5838_low_3 (Length: 231)
Name: NF5838_low_3
Description: NF5838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5838_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 107 - 212
Target Start/End: Complemental strand, 53288982 - 53288873
Alignment:
| Q |
107 |
tttgcattaaatttggcaaatggtatacattctattttttaaaaattatccat----caattattaagagagaaaaacgattaatcttttaatttatttc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
53288982 |
tttgcattaaatttggcaaatggtatacattctattttttttaaattatccatcaatcaattattaagagagaaaaatgattaatcttttaatttttttc |
53288883 |
T |
|
| Q |
203 |
gtttaattag |
212 |
Q |
| |
|
|||||||||| |
|
|
| T |
53288882 |
gtttaattag |
53288873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University