View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5839_high_13 (Length: 372)
Name: NF5839_high_13
Description: NF5839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5839_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 337; Significance: 0; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 20 - 368
Target Start/End: Original strand, 30325523 - 30325871
Alignment:
| Q |
20 |
ctcaactccatcaacccagatttcccatggaccactcgcttccccggcgacctctgtcgcttcccaccacccggcattgtttgccgttactcctactttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30325523 |
ctcaactccatcaacccagatttcccatggaccactcgcttccccggcgacctctgtcgcttcccaccacccggcattgtttgccgttactcctactttc |
30325622 |
T |
 |
| Q |
120 |
attttcttcagtatcgcaaatttaaatcacacattgaacaacttcactttggcaactacgtttttgatgaaagaccaaccctactaccatgttcttccca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30325623 |
attttcttcagtatcgcaaatttaaatcacacattgaacaacttcactttggcaactacgtttttgatgaaagaccaaccctactaccatgttcttccca |
30325722 |
T |
 |
| Q |
220 |
taatgccactctcaacccacttctcttcacccctttcaactacctccgattactcaccttccgtgaatgcttcaacaacccagaaaaccccattaacctc |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30325723 |
taatgccactctcaacccacttctcttcacccctttcaactacctccgattactcaccttccgtgaatgcttcaacaacccagaaaaccccattaacctc |
30325822 |
T |
 |
| Q |
320 |
tctctttccccttttcctccatctctagaacatcttatattcttcgaca |
368 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| ||||| |||| |
|
|
| T |
30325823 |
tctctttcccctttccctccatctctagaacatcttattttctttgaca |
30325871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 20 - 139
Target Start/End: Original strand, 30337160 - 30337279
Alignment:
| Q |
20 |
ctcaactccatcaacccagatttcccatggaccactcgcttccccggcgacctctgtcgcttcccaccacccggcattgtttgccgttactcctactttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| || ||||||||| |||||||||||||||||||||||| |
|
|
| T |
30337160 |
ctcaactccatcaacccagatttcccatggacaactcgcttctccggcgacctctgtcgcttacccccacccggcgttgtttgccgttactcctactttc |
30337259 |
T |
 |
| Q |
120 |
attttcttcagtatcgcaaa |
139 |
Q |
| |
|
|| ||||| ||||||||||| |
|
|
| T |
30337260 |
atcttcttaagtatcgcaaa |
30337279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 241 - 299
Target Start/End: Original strand, 30337381 - 30337439
Alignment:
| Q |
241 |
tctcttcacccctttcaactacctccgattactcaccttccgtgaatgcttcaacaacc |
299 |
Q |
| |
|
||| |||||||||||||||||||| || ||||| ||||||||||||||||||||||| |
|
|
| T |
30337381 |
tcttttcacccctttcaactaccttggaaaactcatcttccgtgaatgcttcaacaacc |
30337439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 230 - 298
Target Start/End: Original strand, 30332972 - 30333040
Alignment:
| Q |
230 |
ctcaacccacttctcttcacccctttcaactacctccgattactcaccttccgtgaatgcttcaacaac |
298 |
Q |
| |
|
||||||||| | ||||| |||||||||||||||||||| |||||| |||| |||||||||||||| |
|
|
| T |
30332972 |
ctcaacccaatactcttaacccctttcaactacctccgcaaactcacattccacaaatgcttcaacaac |
30333040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University