View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5839_high_14 (Length: 355)

Name: NF5839_high_14
Description: NF5839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5839_high_14
NF5839_high_14
[»] chr4 (1 HSPs)
chr4 (281-345)||(31396130-31396194)


Alignment Details
Target: chr4 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 281 - 345
Target Start/End: Complemental strand, 31396194 - 31396130
Alignment:
281 aatggtaatagttatcaattcatttgtatggtagaatgtttataaataagttgttggtgcctatg 345  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31396194 aatggtaatagttatcaattcatttgtatggtagaatgtttataaataagttgttggtgcctatg 31396130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University