View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5839_high_14 (Length: 355)
Name: NF5839_high_14
Description: NF5839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5839_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 281 - 345
Target Start/End: Complemental strand, 31396194 - 31396130
Alignment:
| Q |
281 |
aatggtaatagttatcaattcatttgtatggtagaatgtttataaataagttgttggtgcctatg |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31396194 |
aatggtaatagttatcaattcatttgtatggtagaatgtttataaataagttgttggtgcctatg |
31396130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University