View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5839_high_15 (Length: 339)
Name: NF5839_high_15
Description: NF5839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5839_high_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 17 - 323
Target Start/End: Complemental strand, 2757659 - 2757353
Alignment:
| Q |
17 |
aaaaacagggccggctaatccaacnnnnnnncaaaggtcagaagctaaattatactcaaatactaaagagtagtttttaactttctaccac-aagaagat |
115 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2757659 |
aaaaacagggccggctaatccaacaaaaaa-caaaggtcagaagctaaattatactcaaatactaaagagtagtttttaactttctaccactaagaagat |
2757561 |
T |
|
| Q |
116 |
aaagcttcaaaatataattatagcccgaatcaaattatccttcattggtaaccgattgcgtaagaaccgccaaataaataaagaaaccttaaaggaacaa |
215 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | || |
|
|
| T |
2757560 |
aaagcttcaaaatataattataagccgaatcaaattatccttcattggtaaccgattgcgtaagaaccgccaaataaataaagaaacctcaaagggataa |
2757461 |
T |
|
| Q |
216 |
ctttgttcaagacagcctcagaggtgttagattgatcaacctactctacggttgactcgaagacagttgtagataacgtctatggtagtagagacaacgt |
315 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2757460 |
cttttttcaagacagtctcagaggtgttagattgatcaacttactttacggttgactcgaagacagttgtagataacgtttatggtagtagagacaacgt |
2757361 |
T |
|
| Q |
316 |
ctcaaatt |
323 |
Q |
| |
|
|||||||| |
|
|
| T |
2757360 |
ctcaaatt |
2757353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 273 - 323
Target Start/End: Complemental strand, 2757337 - 2757287
Alignment:
| Q |
273 |
cgaagacagttgtagataacgtctatggtagtagagacaacgtctcaaatt |
323 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2757337 |
cgaagacggttgtagataatgtctatggtagtagagacaacgtctcaaatt |
2757287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University